Plan quality score to evaluate the dwell time deviation restricted inverse planning by simulated annealing and graphically optimized treatment plans for template based interstitial brachytherapy.

PURPOSE: To evaluate the impact of dwell time deviation constraint (DTDC) on the quality of IPSA-optimized treatment plans in comparison with graphical plans using plan quality scores (PQS). MATERIAL AND METHODS: Seventy optimized plans (graphical & IPSA with different DTDC values) of ten cervical cancer patients were generated. Various DVH parameters like D90, V100, V150, V200, V300 were compared to evaluate the impact of DTDC on target coverage and high dose regions inside target for different plans. Similarly, for the OAR dose, values of D2cc were compared. Various planning parameters like CI, COIN, DHI, DNR, ODI, EI and gain factor (GF) for different OARs were calculated. Based on these indices a plan quality score (PQS) was formulated and calculated. PQS values were used to see the impact of DTDC on plan quality of IPSA in comparison with dosimetric quality of graphical plan. RESULTS: We have found that target coverage is similar for IPSA and graphically optimized treatment plans. However, dose homogeneity was improved in IPSA compared to graphical optimization whereas conformality was better in graphically optimized plans. OAR dose was less in IPSA plans. High-dose regions inside the target were also reduced in IPSA comparatively. However, IPSA plans optimized with various values of DTDC did not necessarily reduce high-dose regions beyond 0.6. Plan quality scores (PQS) were 6.31, 6.31, 6.34, and 6.17 for the graphically optimized plan, IPSA with DTDC values of 0.0, 0.4, and 1.0 respectively. CONCLUSION: We found that IPSA is dosimetrically advantageous over graphical optimization. IPSA with a DTDC value of 0.4 improved overall plan quality. However, DTDC value beyond 0.6 produces dosimetrically sub-optimal plans hence the use of DTDC should be very selective and limited.

Use of geographical information systems (GIS) in assessing ecological profile, fish community structure and production of a large reservoir of Himachal Pradesh.

The present study demonstrates the spatial analysis and mapping of fish and different measures of environmental parameters and fish diversity of Pong reservoir, Himachal Pradesh, using Kriging spatial interpolation methods for geographical information system mapping. Seasonal data on environmental parameters, potential fish habitat and fish diversity was collected from lentic (dam), lentic (reservoir), transitional and lotic zone of the reservoir.. Important environmental parameters like water temperature, dissolved oxygen, electrical conductivity, water depth and transparency showed variations across the different zones of the reservoir. The sediment of the reservoir was sandy clay loam in nature as per texture analysis. Fish species richness, Shannon index and evenness index showed a similarity of the lotic and lentic (reservoir) zones of the reservoir. Six potential fish breeding grounds were identified in the reservoir indicating high conservation significance. The analysis of data showed a declining trend in fish production from 456.9 tonnes during the decade 1976-1987 to 347.91 tonnes during 2009-2020. The factors like anthropogenic climate change, predation of a stocked fish juvenile by water birds, undersized fish stocking and unscientific management are the probable reasons for the decreasing fish production. The spatial variation pattern of the water spread area, environmental parameters, fish catch and potential fish breeding grounds depicted in the GIS platform can be used as an important information base by the policy makers for fisheries management. The stocking of large size fish as a stocking material and adequate protection of the potential fish breeding grounds are the key advisories for the sustainable enhancement of fisheries as well as conservation.

Effect of pearlitic morphology with varying fineness on the cavitation erosion behavior of eutectoid rail steel.

The present work discusses the effect of the pearlitic morphology with varying fineness on the cavitation erosion behavior of eutectoid rail steel. Cavitation erosion of three different types of the pearlitic steels (furnace-cooled, air-cooled, and forced-air-cooled) consisting of coarse, fine, and very fine microstructures were tested in 3.5% NaCl solution and compared with that of the as-received pearlitic rail steel. The variation in the mean depth of erosion (MDE) and mean depth erosion rate (MDER) with erosion time was analyzed. Furthermore, the cavitation erosion resistance of the as-received, the air-cooled, and the forced-air-cooled was found to be 1.03, 1.51, and 2.14 times better than the furnace-cooled pearlitic steel, respectively. It was concluded that the cavitation erosion resistance of the pearlitic steel increased with the increase in the fineness of the microstructure.

Mn-site doping and its effect on inverted hysteresis and thermomagnetic irreversibility behavior of antiferromagnetic Mn5Si3 alloy.

The structural and magnetic behavior of Mn-site doped intermetallic manganese silicide alloys of nominal compositions Mn5-x A x Si3 (x = 0.05, 0.1, 0.2 and A = Ni, Cr) have been investigated with a focus to the inverted hysteresis behavior and thermomagnetic irreversibility. Room temperature x-ray powder diffraction data confirm that all the doped alloys crystallize in hexagonal D88 type structure with space group P63/mcm. The doped alloys are found to show paramagnetic-collinear antiferromagnetic (AFM2)-noncollinear antiferromagnetic (AFM1) transitions during cooling from room temperature. A significant decrease in the critical values of both AFM1-AFM2 transition temperatures and fields have been observed with the increasing Ni/Cr concentration. Inverted hysteresis loop, field-induced arrest, and thermomagnetic arrest, the key features of the undoped Mn5Si3 alloy, are found to be significantly affected by the Mn-site doping and eventually vanishes with 4% doping.

Bifidobacteria and its rice fermented products on diet induced obese mice: analysis of physical status, serum profile and gene expressions.

Obesity is highly correlated with the dysbiosis of intestinal microbiota, and bifidobacteria are one of the soft targets of this metabolic syndrome. The aim of this study is to evaluate the efficacy of Bifidobacterium sp. MKK4 and rice-based fermented foods on physical, haematological, gut microbiota and lypogenic-lypolytic marker genes in diet-induced obese mice. Adult male mice (21±0.7 g) were randomly divided into four groups (n=10) according to the type of diet: normal diet (ND), high fat diet (HFD), HFD supplemented with Bifidobacterium sp. MKK4 and HFD supplemented with MKK4 associated rice-fermented food. 8 weeks of bacterial therapy in the obese mice resulted in significant reduction of body and organ weights, improved serum levels of glucose, triglyceride and cholesterol, the histological structure of the liver (steatosis), and re-establishment of gut Lactobacillus, Bifidobacterium and Bacteroides species. The bacterial therapy led to up-regulation of lipolytic transcription factors, such as peroxisome proliferator-activated receptor (PPAR)-α, PPAR-δ, and their regulated gene products in fatty acid metabolism and glucose uptake, such as acyl-CoA oxidase, carnitine palmitoyl-transferase-1, uncoupling protein-3 and glucose transporter-4. Concomitantly, both adipocytogenesis and fatty acid synthesis were arrested as reflected by the down-regulation of sterol regulatory element binding protein-1c, acetyl-CoA carboxylase, fatty acid synthase and tumour necrosis factor alpha genes. The effectiveness of the fermented product was more profound than the single bacterium. These data provide experimental support with regard to the use of Bifidobacterium sp. MKK4 as a natural therapeutic agent to control obesity.

NOX1 loss-of-function genetic variants in patients with inflammatory bowel disease.

Genetic defects that affect intestinal epithelial barrier function can present with very early-onset inflammatory bowel disease (VEOIBD). Using whole-genome sequencing, a novel hemizygous defect in NOX1 encoding NAPDH oxidase 1 was identified in a patient with ulcerative colitis-like VEOIBD. Exome screening of 1,878 pediatric patients identified further seven male inflammatory bowel disease (IBD) patients with rare NOX1 mutations. Loss-of-function was validated in p.N122H and p.T497A, and to a lesser degree in p.Y470H, p.R287Q, p.I67M, p.Q293R as well as the previously described p.P330S, and the common NOX1 SNP p.D360N (rs34688635) variant. The missense mutation p.N122H abrogated reactive oxygen species (ROS) production in cell lines, ex vivo colonic explants, and patient-derived colonic organoid cultures. Within colonic crypts, NOX1 constitutively generates a high level of ROS in the crypt lumen. Analysis of 9,513 controls and 11,140 IBD patients of non-Jewish European ancestry did not reveal an association between p.D360N and IBD. Our data suggest that loss-of-function variants in NOX1 do not cause a Mendelian disorder of high penetrance but are a context-specific modifier. Our results implicate that variants in NOX1 change brush border ROS within colonic crypts at the interface between the epithelium and luminal microbes.

Alteration of predominant gastrointestinal flora and oxidative damage of large intestine under simulated hypobaric hypoxia.

Hypobaric hypoxia is an immediate and crucial starting mechanism of acute mountain sickness included with some non-specific gastrointestinal (GI) complications. To study the effect of hypoxia on GI microflora and its upshot to this system, male albino rats were exposed to 55 kPa (air pressure ~ 4872.9 m altitude) consecutively 30 days for 8 hours/day. The different indicator group of large intestinal microbial populations were enumerated and correlated with the levels of antioxidant indicators like catalase (CAT), superoxide dismutase (SOD), malondialdehyde (MDA), reduced glutathione (GSH) and oxidized glutathione (GSSG) of large intestinal epithelial cells. In addition, the histological study was performed by haematoxylin eosin (HE), periodic acid schiff staining (PAS) and scanning electron microscopy (SEM). It was observed that the density of total aerobes (104 folds) significantly (p < 0.05) decreased but the population of total anaerobes (209 folds) and Escherichia coli (125 folds) elevated after 30 days of hypoxic stress. The strict anaerobes like Bifidobacterium spp. (3 folds), Bacteroides spp. (134 folds), Lactobacillus spp. (7 folds) and other selected obligate anaerobes like Clostridium perfringens (40 folds), Peptostreptococcus spp. (21 folds) increased in respect to their control population. The growth direction index (GDI) of anaerobic populations was positive and correlated with gas formation aptitude. The activities of CAT and SOD in the large intestinal epithelia decreased significantly (p < 0.05) and GSH/GSSG pool turned into oxidized state with higher MDA (p < 0.05) formation. Histological study revealed the necrotized epithelial layer with higher lymphocytes infiltration in lamina propia accompanied by reduction of acidic mucins secreting goblet cells. From this experiment, it can be hypothesized that high altitude induced hypoxia manipulated the bacterial imprint and damaged the epithelial barrier of the large intestine which may cause systemic infection.

Evaluation of anti-infective potential of a tribal folklore Odina wodier Roxb against some selected microbes and herpes simplex virus associated with skin infection.

AIM: To evaluate the in vitro antimicrobial activity of aqueous and methanol extracts of Odina wodier bark (OWB), a folk medicine, against representative bacteria, fungi and herpes simplex virus (HSV) associated with skin infections. METHODS AND RESULTS: The OWB extract(s) was found to inhibit the isolates of Staphylococcus aureus, Bacillus subtilis, Pseudomonas aeruginosa, Klebsiella pneumonia, Escherichia coli at an MIC of 256-5000 µg ml(-1) and Candida albicans at and above 4000 µg ml(-1) by agar and broth dilution assays. The growth curve of Staph. aureus revealed the highest activity within 2-6 h of methanol extract (ME) exposure. Interestingly, the MTT and plaque reduction assay showed that the extracts can inhibit HSV-1 and HSV-2 at EC50 of 22·4 and 28·8 µg ml(-1) , with Selectivity index of 11·7-15. While the time kinetic and binding assays demonstrated that the ME at 50 µg ml(-1) prevents viral attachment into Vero cells. Phytochemical and HPLC analysis of ME revealed the presence of flavonoids, phytosterols, saponins and tannins including the pseudotannin chlorogenic acid. CONCLUSION: The traditional use of OWB for the management of skin infections has scientific basis. SIGNIFICANCE AND IMPACT OF THE STUDY: This study demonstrated the antimicrobial potential of OWB on selected isolates of bacteria, fungi and HSV, associated with skin infections.

Epidemiology and laboratory diagnosis of fungal corneal ulcer in the Sundarban Region of West Bengal, eastern India.

INTRODUCTION: Corneal ulcers are the second most-common cause of preventable blindness after cataract in tropical developing countries. Fungal corneal ulcers constitute 30 to 62 % of the total microbial culture-positive corneal ulcers. OBJECTIVE: To study the epidemiological characteristics, risk factors and laboratory diagnosis of fungal corneal ulcer in the Sundarban Region, West Bengal, eastern India. MATERIALS AND METHODS: A retrospective review of 399 culture-positive, fungal corneal ulcers out of a total 928 corneal ulcer patients attending a tertiary care hospital in Kolkata,eastern India, over a period of four years from February 2007 to January 2011. RESULTS: Males (246; 61.65 %) were more commonly affected than females (P less than .0001).The affected people were mostly (342; 85.71 %) residing in the rural areas (P less than .0001). 196 patients (49.12 %) were involved in agricultural activities (P less than .0001). The younger people of, 21 - 50 years of age, were particularly prone to this disease (269; 67.41 %). Corneal trauma (354; 88.72 %) was the commonest risk factor (P less than .0001) and 261 patients (61.41 %) had a history of trauma with vegetative matter (P less than .0001). The use of topical corticosteroids was implicated in 65 (16.29 %) cases. The incidence of the disease was highest in the monsoon season, between June to September (192; 48.12 %). The aspergillus spp was the most common fungal growth (151; 37.84 %), followed by an Fusarium spp (81; 20.3 %). CONCLUSION: The fungal corneal ulcers are an important cause of ocular morbidity in people residing in the Sundarban Region. The identification of the etiology and the predisposing factors of corneal ulcers in this region are important for the prevention and early treatment of the disease.

Fruit Rot of Tinda Caused by Pseudomonas aeruginosa-A New Report from India.

Fruit rot disease (FRD), an emerging problem of tinda (Praecitrullus fistulosus) in India. FRD epidemics begin during rainy and warm weather and often spoil marketable produce. Symptoms appear as numerous, pale brown-to-dark brown, deeply penetrating circular soft rot lesions on fleshy fruit tissues. Noneffervescent bacterial exudates occasionally form on lesions. Repeated isolations from FRD-affected tinda fruits consistently yielded the same bacterial species. Inoculation of the isolated bacterium into asymptomatic tinda fruits produced identical soft rot symptoms. Fruits were inoculated with the isolate ITCC B0030 (0.1 OD) by removing a 2.0-cm deep tissue plug with a sterile cork borer (5 mm in diameter) and injecting the inoculum with a syringe in the cylindrical cavity. After inoculation, the plug (upper 5 mm) was reinserted, sealed with sterile paraffin, and covered with a small piece of wet absorbent cotton to prevent dehydration. High humidity (>90%) and 30 to 33°C temperature was maintained after inoculation in a glasshouse. After 4 to 10 days, fruits showed FRD symptoms. The reisolated bacterium from artificially inoculated symptomatic fruits was identical with the original inoculated bacterium. Identity of the bacterial pathogen for FRD was confirmed by phenotypic and genotypic methods. The causal bacterium was a gram-negative, non-sporing motile rod with a single polar flagellum. The bacterium produced yellowish green and blue-green diffusible pigments on King's B (KB) medium. On yeast dextrose calcium carbonate agar at 30°C, the colonies produced abundant, blue, diffusible pigment within 48 h. The bacterium grew at temperatures up to 42°C but not at 4°C. Excellent growth occurred on Salmonella-Shigella agar and MaConkey's medium, as reported also for Pseudomonas aeruginosa strain P8. The bacterium produced ammonia, hydrogen sulfide, arginine dihydrolase, urease, lipase, catalase, gelatinase, and casinase but not amylase, indole, or acetyl methyl carbinol. The bacterium was identified as P. aeruginosa using Biolog based Bacterial Identification System version 4.2 (Biolog Inc., Hayward, CA). The bacterium did not utilize cellobiose, dulcitol, maltose, sorbitol, sucrose, arabinose, and starch. Upon infiltration on tobacco leaves (Nicotiana tabacum cv. Xanthi) at 107 or more cells ml-1, the bacterium gave a strong hypersensitive reaction within 24 h. Transmission electron micrographs (TEM, KYKY 1000B, Japan) of the causal bacterium revealed a single, polar flagellum. Identity was further confirmed as P. aeruginosa based on 16S rRNA sequence (1,491 nt) analysis with universal primers F1 (5'-GAGTTTGATCCTGGCTCAG-3') and R13 (5'-AGAAAGGAGGTGATCCAGCC-3'). A blastN search of GenBank revealed a >99% nt identity with P. aeruginosa strain TAUC 7 (HQ914782). The 16S rRNA gene sequence (1,491 nt) was deposited in Bankit GenBank (JF797204). To our knowledge, this is the first report of fruit rot of tinda caused by P. aeruginosa in India (ITCC B0030) and a new record of bacterial rot of Praecitrullus fistulosus induced by a fluorescent and blue-green pigment producing P. aeruginosa. To date, P. syringae pv. lachrymans and a nonfluorescent P. pseudoalcaligenes subsp. citrulli were reported to infect Citrullus lanata (1) and Praecitrullus fistulosus (2), respectively. References: (1) D. L. Hopkins and N. C. Schenck. Phytopathology 62:542, 1972. (2) N. W. Schaad et al. Int. J. Syst. Bacteriol. 28:117, 1978.

Purification and characterization of an endoxylanase from the culture broth of Bacillus cereus BSA1.

An extracellular xylanase from the fermented broth of Bacillus cereus BSA1 was purified and characterized. The enzyme was purified to 3.43 fold through ammonium sulphate precipitation, DEAE-cellulose chromatography and followed by gel filtration through Sephadex G-100 column. The molecular mass of the purified xylanse was about 33 kDa. The enzyme was an endoxylanase as it initially degraded xylan to xylooligomers. The purified enzyme showed optimum activity at 55 degrees C and at pH 7.0 and remained reasonably stable in a wide range ofpH (5.0-8.0) and temperature (40-65 degrees C). The Km and Vmax values were found to be 8.2 mg/ml and 181.8 micromol/(min mg), respectively. The enzyme had no apparent requirement ofcofactors, and its activity was strongly inhibited by Cu++, Hg++. It was also a salt tolerant enzyme and stable upto 2.5 M of NaCl and retained its 85% activity at 3.0 M. For stability and substrate binding, the enzyme needed hydrophobic interaction that revealed when most surfactants inhihited xylanase activity. Since the enzyme was active over wide range ofpH, temperature and remained active in higher salt concentration, it could find potential uses in biobleaching process in paper industries.

A New Leaf Blight of Rice Caused by Pantoea ananatis in India.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 µm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

Variation of 18 STR loci in Shahabadi sheep of India.

Shahabadi sheep represent an important but uninvestigated source of genetic diversity. Eighteen microsatellite markers were employed to analyze the genetic diversity of Shahabadi sheep population found in Bihar, India with fifty samples. Microsatellites were highly polymorphic with a mean allelic number 5.56 +/- 1.79. The observed heterozygosity, expected heterozygosity and observed and effective number of alleles were used to estimate the genetic variation of this breed. The observed heterozygosity in the population varied from 0.279-0.739 with the mean of 0.501 +/- 0.151, reflecting substantial genetic variation in this population. Population was observed to be heterozygote deficient (21.5%). The results of this study indicated that conservation of genetic variation in Shahabadi population should be considered by breeders, in the interest of long term future of the breed in its native tract.

Tannase production by Aspergillus aculeatus DBF9 through solid-state fermentation.

Tannase an industrially important enzyme was produced by Aspergillus aculeatus DBF9 through a solid-state fermentation (SSF). The organism produced good amount of enzyme and gallic acid in wheat bran among the solid substrate used in SSF. Maximum enzyme and gallic acid production occurred in 5% tannic acid after 72 h. Eighty percent initial substrate moisture and 30 degrees C temperature was found suitable for tannase production.

Production of tannase by the immobilized cells of Bacillus licheniformis KBR6 in Ca-alginate beads.

AIMS: The present study was aimed at finding the optimal conditions for immobilization of Bacillus licheniformis KBR6 cells in calcium-alginate (Ca-alginate) beads and determining the operational stability during the production of tannin-acyl-hydrolase (tannase) under semicontinous cultivation. METHODS AND RESULTS: The active cells of B. licheniformis KBR6 were immobilized in Ca-alginate and used for the production of tannase. The influence of alginate concentration (5, 10, 20 and 30 g l(-1)) and initial cell loading on enzyme production were studied. The production of tannase increased significantly with increasing alginate concentration and reached a maximum enzyme yield of 0.56 +/- 0.03 U ml(-1) at 20 g l(-1). This was about 1.70-fold higher than that obtained by free cells. The immobilized cells produced tannase consistently over 13 repeated cycles and reached a maximum level at the third cycle. Scanning electron microscope study indicated that the cells in Ca-alginate beads remain in normal shape. CONCLUSIONS: The Ca-alginate entrapment is a promising immobilization method of B. licheniformis KBR6 for repeated tannase production. Tannase production by immobilized cells is superior to that of free cells because it leads to higher volumetric activities within the same period of fermentation. SIGNIFICANCE AND IMPACT OF THE STUDY: This is the first report of tannase production from immobilized bacterial cells. The bacterium under study can produce higher amounts of tannase with respect to other fungal strains within a short cultivation period.

A rapid colony screening method for the detection of arsenate-reducing bacteria.

A rapid and simple method has been developed for the detection of arsenate reducing bacteria based on the presence of arsenite [As (III)], the end product of anaerobic arsenate [As (V)] respiration. Confirmation of As (III) product is made by the reduction of starch-iodine complex. The method can be used over a large pH range (5.5-9.0) and can easily be determined at arsenite concentration as low as 0.025 mM. Major advantages of this technique are that a large number of samples can be analyzed easily at a time.

Kinetic studies on the CuO/gamma-Al2O3 sorbent regeneration by methane--topochemical approach.

CuO impregnated gamma-Al2O3 support provides convenient adsorption and regeneration characteristics. These features give the potential to regard this chemisorption process as more effective, feasible and widely accepted than lime and limestone scrubbing in the removal of SO2 from the outlet gases. Thermogravimetric tests on the regeneration of the CuO/gamma-Al2O3 exhausted sorbent (first stage of the regeneration, CuSO4-->Cu0) with methane were conducted. Commercially available 1/8" gamma-Al2O3 spheres, loaded with 5.8 wt % of Cu were investigated. The tests concerning the isothermal regeneration kinetics were performed at temperatures: T = 700, 727 and 750 K, while a 20 cm3 min(-1) flow of pure methane was used. To select the mechanism of the regeneration reaction, as well as to evaluate their kinetic parameters of the rate equations, the TGA data were compared with the series of theoretical topochemical kinetic models as advocated by Gardner, Hancock and Sharp's approach. The kinetic mechanism of the regeneration reaction in the initial stage of the process may be originally interpreted as the combination of both boundary-surface-controlled reaction (contracting sphere) and the first-order kinetics models. Various diffusion limited kinetic equations have proved useful for the description of the final stage of the process. Both proposed models (two kinetic and four diffusion ones) fit fairly well to the experimental data (in their limited validity ranges) obtained in all three temperature values studied.

Antidiarrhoeal activity of Cyperus rotundus.

The methanol extract of Cyperus rotundus rhizome, given orally at the doses of 250 and 500 mg/kg b.w., showed significant antidiarrhoeal activity in castor oil induced diarrhoea in mice. Among the fractions, tested at 250 mg/kg, the petroleum ether fraction (PEF) and residual methanol fraction (RMF) were found to retain the activity, the latter being more active as compared to the control. The ethyl acetate fraction (EAF) did not show any antidiarrhoeal activity.

Selenate removal from sulfate containing aqueous solutions.

The performance of selenium remediation agents, mainly gamma alumina sorbents and zerovalent metals is greatly inhibited in the presence of large concentrations of sulfate found in selenium-rich agricultural drainage water. It is therefore imperative to remove sulfates from these contaminated waters, prior to their treatment for selenium removal. This paper presents data on enhanced selenium removal resulting from a two stage process involving the use of barium chloride in the first stage followed by a selenium remediation agent in the second. Barium chloride is known to stoichiometrically precipitate out sulfates. In addition to the sulfate removal from the contaminated solutions, a significant amount of selenate immobilization in the precipitated solids was achieved. When a loading of 15 g l(-1) of BaCl2, was employed, 100% selenate removal from an aqueous solution (containing 1 mg l(-1) selenate, 4 g l(-1) of sulfate and 2.5 g l(-1) of chloride) was achieved by the use of BaCl2, alone. Bimetallic NiFe particles, gamma alumina and activated carbon were employed to further remove selenium in the second stage. A solution containing 1 mg l(-1) and 4 g l(-1) of selenate and sulfate, respectively, when treated sequentially with 10 g l(-1) of BaCl2 and NiFe powder showed 100% selenium removal.